Stem-loop sequence mtr-MIR395c

AccessionMI0005070 (change log)
DescriptionMedicago truncatula miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention mtr-MIR395c
(12 sentences)

Stem-loop
            ug           cau     uau      gg      a 
5' gaguuccuu  aacgcuucaug   gagaa   cuauuu  ucuaau u
   |||||||||  |||||||||||   |||||   ||||||  ||||||  
3' cucaagggg  uugugaaguau   cuuuu   gauaga  agauua c
            gu           cuu     -cu      aa      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16622264-16622360 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR395c
mtr-MIR395cchr5: 16622264-16622360 [-]
mtr-MIR395dchr5: 16616400-16616494 [-]
Database links

Mature sequence mtr-miR395c

Accession MIMAT0003856
Sequence

77 - 

augaaguguuugggggaacuc

 - 97

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).