Stem-loop sequence bta-mir-363

AccessionMI0005069 (change log)
DescriptionBos taurus miR-363 stem-loop
Gene family MIPF0000138; mir-363
Literature search

6 open access papers mention bta-mir-363
(15 sentences)

Stem-loop
   ug   u         ca  a         --ga   gu 
5'   uug cggguggau  cg ugcaauuuu    uua  a
     ||| |||||||||  || |||||||||    |||   
3'   agc gucuaccua  gc acguuaaaa    gau  u
   ca   -         ug  -         agag   aa 
Get sequence
Deep sequencing
6362 reads, 37 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18021032-18021105 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-363
bta-mir-106achrX: 18021857-18021937 [-]
bta-mir-18bchrX: 18021698-18021772 [-]
bta-mir-20bchrX: 18021463-18021531 [-]
bta-mir-19b-2chrX: 18021338-18021420 [-]
bta-mir-92a-2chrX: 18021187-18021254 [-]
bta-mir-363chrX: 18021032-18021105 [-]
Database links

Mature sequence bta-miR-363

Accession MIMAT0003855
Sequence

51 - 

auugcacgguauccaucugcg

 - 71

Get sequence
Deep sequencing6235 reads, 73 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).