Stem-loop sequence bta-mir-34c

Accession MI0005068
Description Bos taurus miR-34c stem-loop
Gene family MIPF0000039; mir-34
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-34_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-34 microRNA precursor family are non-coding RNA molecules that, in mammals, give rise to three major mature miRNAs. The miR-34 family members were discovered computationally and later verified experimentally. The precursor miRNA stem-loop is processed in the cytoplasm of the cell, with the predominant miR-34 mature sequence excised from the 5' arm of the hairpin. The mature miR-34a is a part of the p53 tumor suppressor network of proteins; therefore, it is hypothesized that miR-34 dysregulation is involved in the development of some cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ag     a   a    a     c      c  a 
agucu  uuacu ggc gugu guuag ugauug ua u
|||||  ||||| ||| |||| ||||| |||||| ||  
uuaga  aaugg ccg caca caauc acuaac au a
     aa     a   g    c     -      c  a 
Get sequence
Comments

The mature miR-34c sequence identified by Sonstegard et al [1] has an A base at position 11 of the mature miRNA, which conflicts with the draft genome sequence that has G as shown here.

Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr15: 22135426-22135502 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-34c
bta-mir-34b chr15: 22134725-22134808 [+]
bta-mir-34c chr15: 22135426-22135502 [+]
Database links

Mature sequence bta-miR-34c

Accession MIMAT0003854
Sequence

13 - 

aggcaguguaguuagcugauug

 - 34

Get sequence
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).