miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0005064

Accession MI0005064
ID bta-mir-30c
Description Bos taurus miR-30c stem-loop
Stem-loop 
ca   u  -aa     cc    ugu u       u   aca        ug gag 
  gac gu   ccaug  guag   g guaaaca ccu   cucucagc  u   c
  ||| ||   |||||  ||||   | ||||||| |||   ||||||||  |   u
  cug ca   gguac  cguc   c cauuugu ggg   gagggucg  g   c
--   -  aaa     --    uuc u       u   --a        gu gag
Get sequence
Comments

The mature miR-30c sequence identified by Sonstegard et al [1] has an additional G base at the 3' end, which conflicts with the draft genome sequence.

Genome context
Coordinates (BTAU4.0) Overlapping transcripts
3: 112437430-112437534 [-]
sense
ENSBTAT00000029254 ; NFYC_BOVIN; intron 5
ENSBTAT00000025381 ; NFYC_BOVIN; intron 5
Clustered miRNAs
< 10kb from bta-mir-30c
bta-mir-30e 3: 112440564-112440655 [-]
bta-mir-30c 3: 112437430-112437534 [-]
Gene family

MIPF0000005; mir-30

Mature sequence MIMAT0003850

Accession MIMAT0003850
ID bta-miR-30c
Sequence

26 -  

uguaaacauccuacacucucagc

 - 48

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).