|
miRBase |
|
Stem-loop sequence MI0005064 |
||||||
| Accession | MI0005064 | |||||
| ID | bta-mir-30c | |||||
| Description | Bos taurus miR-30c stem-loop | |||||
| Stem-loop |
ca u -aa cc ugu u u aca ug gag gac gu ccaug guag g guaaaca ccu cucucagc u c ||| || ||||| |||| | ||||||| ||| |||||||| | u cug ca gguac cguc c cauuugu ggg gagggucg g c -- - aaa -- uuc u u --a gu gag |
|||||
| Comments |
The mature miR-30c sequence identified by Sonstegard et al [1] has an additional G base at the 3' end, which conflicts with the draft genome sequence. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links |
|
|||||
| Gene family |
MIPF0000005; mir-30 |
|||||
Mature sequence MIMAT0003850 |
|
| Accession | MIMAT0003850 |
| ID | bta-miR-30c |
| Sequence |
26 - uguaaacauccuacacucucagc - 48 |
| Evidence | experimental; cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|