Stem-loop sequence bta-mir-122

AccessionMI0005063 (change log)
Previous IDsbta-mir-122a
DescriptionBos taurus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

33 open access papers mention bta-mir-122
(128 sentences)

Stem-loop
   c        -      gg       c           --u  c 
5'  cuuagcag agcugu  aguguga aaugguguuug   gu c
    |||||||| ||||||  ||||||| |||||||||||   ||  
3'  ggauuguc ucgaua  ucacacu uuaccgcaaac   ca a
   c        a      aa       a           uau  a 
Get sequence
Deep sequencing
2089 reads, 37.5 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature miR-122 sequence identified by Sonstegard et al [1] has an additional C base at the 5' end, which conflicts with the draft genome sequence.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr24: 58263337-58263421 [+]
intergenic
Database links

Mature sequence bta-miR-122

Accession MIMAT0003849
Previous IDsbta-miR-122a
Sequence

15 - 

uggagugugacaaugguguuug

 - 36

Get sequence
Deep sequencing2084 reads, 16 experiments
Evidence experimental; cloned [1,3], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3