Stem-loop sequence bta-mir-150

Accession MI0005058
Description Bos taurus miR-150 stem-loop
Gene family MIPF0000197; mir-150
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
------ccuc     u  c  -           aacc          u  g    
          ucucc ca gg cccugucuccc    cuuguaccag gu ugu 
          ||||| || || |||||||||||    |||||||||| || || c
          agggg gu cc gggacggaggg    ggacaugguc ca acu 
cgacgacccu     -  -  a           gcau          c  g    
Get sequence
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr18: 56407843-56407942 [-]
sense
ENSBTAT00000061135 ; E1B7V8_BOVIN; intron 15
Database links

Mature sequence bta-miR-150

Accession MIMAT0003845
Sequence

21 - 

ucucccaacccuuguaccagugu

 - 43

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).