|
miRBase |
|
miRBase has moved to http://www.mirbase.org/ - please update your links.
Stem-loop sequence MI0005057 |
||||||||
| Accession | MI0005057 | |||||||
| ID | bta-let-7a-1 | |||||||
| Description | Bos taurus let-7a-1 stem-loop | |||||||
| Stem-loop |
u gu uuagggucacac uggga gag aguagguuguauaguu c ||||| ||| |||||||||||||||| c auccu uuc ucaucuaacauaucaa a - ug uagagggucacc |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Gene family |
MIPF0000002; let-7 |
|||||||
Mature sequence MIMAT0003844 |
|
| Accession | MIMAT0003844 |
| ID | bta-let-7a |
| Sequence |
6 - ugagguaguagguuguauaguu - 27 |
| Evidence | experimental; cloned [1-2] |
| Predicted targets |
|
References |
|
| 1 |
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
| 2 |
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|