Stem-loop sequence bta-mir-200b

AccessionMI0005055 (change log)
DescriptionBos taurus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

17 open access papers mention bta-mir-200b
(42 sentences)

Stem-loop
   c    -    ug     c      u  ug 
5'  cauc uuac  ggcag auugga gg  u
    |||| ||||  ||||| |||||| ||  c
3'  guag aaug  ccguc uaaucu cu  u
   a    u    gu     a      -  gg 
Get sequence
Deep sequencing
25041 reads, 300 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 52695246-52695304 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-200b
bta-mir-200bchr16: 52695246-52695304 [-]
bta-mir-200achr16: 52694578-52694663 [-]
bta-mir-429chr16: 52693343-52693426 [-]
Database links

Mature sequence bta-miR-200b

Accession MIMAT0003842
Sequence

38 - 

uaauacugccugguaaugaug

 - 58

Get sequence
Deep sequencing23516 reads, 76 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).