Stem-loop sequence bta-mir-24-2

AccessionMI0005053 (change log)
Previous IDsbta-mir-24
DescriptionBos taurus miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Literature search

23 open access papers mention bta-mir-24-2
(59 sentences)

Stem-loop
   cu   cc   cg   -cu        --gaaa     u 
5'   cug  ucc  ugc   acugagcu      cacag u
     |||  |||  |||   ||||||||      ||||| g
3'   gac  agg  acg   ugacucgg      guguu a
   -g   -a   --   acu        ucacac     u 
Get sequence
Deep sequencing
86914 reads, 564 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 13045858-13045929 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-24-2
bta-mir-23achr7: 13046186-13046258 [-]
bta-mir-27achr7: 13046007-13046084 [-]
bta-mir-24-2chr7: 13045858-13045929 [-]
Database links

Mature sequence bta-miR-24-3p

Accession MIMAT0003840
Previous IDsbta-miR-24
Sequence

50 - 

uggcucaguucagcaggaacag

 - 71

Get sequence
Deep sequencing85452 reads, 75 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2