Stem-loop sequence bta-mir-10b

AccessionMI0005052 (change log)
DescriptionBos taurus miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

20 open access papers mention bta-mir-10b
(84 sentences)

Stem-loop
   --cag  a     u        a    g     c          u g   c 
5'      ug cguug cuauauau cccu uagaa cgaauuugug g uau c
        || ||||| |||||||| |||| ||||| |||||||||| | |||  
3'      ac guagc gguauaua gggg aucuu gcuuagacac u aug a
   caaaa  -     u        a    -     a          - g   u 
Get sequence
Deep sequencing
6732560 reads, 7.15e+04 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 20876466-20876564 [-]
intergenic
Database links

Mature sequence bta-miR-10b

Accession MIMAT0003839
Sequence

20 - 

uacccuguagaaccgaauuugug

 - 42

Get sequence
Deep sequencing6732150 reads, 75 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2