Stem-loop sequence bta-mir-455

AccessionMI0005049 (change log)
DescriptionBos taurus miR-455 stem-loop
Gene family MIPF0000129; mir-455
Literature search

7 open access papers mention bta-mir-455
(22 sentences)

Stem-loop
   ucccu   -g     -----          u      a   c   gaa 
5'      ggc  ugagg     guaugugccu uggacu cau gug   g
        |||  |||||     |||||||||| |||||| ||| |||    
3'      ccg  acucc     cauauacggg accuga gua cac   c
   ---au   ga     guuca          u      c   c   gac 
Get sequence
Deep sequencing
6753 reads, 0 reads per million, 66 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 105738159-105738247 [+]
sense
ENSBTAT00000042281 ; bta-mir-455-201; exon 1
ENSBTAT00000001200 ; COL27A1-201; intron 10
Database links

Mature sequence bta-miR-455-5p

Accession MIMAT0003835
Previous IDsbta-miR-455
Sequence

16 - 

uaugugccuuuggacuacauc

 - 36

Get sequence
Deep sequencing4351 reads, 66 experiments
Evidence by similarity; MI0003516
Predicted targets

Mature sequence bta-miR-455-3p

Accession MIMAT0003836
Previous IDsbta-miR-455*
Sequence

54 - 

gcaguccaugggcauauacacu

 - 75

Get sequence
Deep sequencing2399 reads, 66 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).