Stem-loop sequence bta-mir-450a-2

AccessionMI0005048 (change log)
Previous IDsbta-mir-450
DescriptionBos taurus miR-450a-2 stem-loop
Gene family MIPF0000128; mir-450
Literature search

5 open access papers mention bta-mir-450a-2
(7 sentences)

Stem-loop
   caaagaaa     u       uuu     u               aa 
5'         gaugc aaacuau   ugcga guguuccuaauaugu  u
           ||||| |||||||   ||||| |||||||||||||||  c
3'         cuaug uuugaua   acguu uacaaggguuaugua  u
   -----uaa     u       cuu     u               aa 
Get sequence
Deep sequencing
5215 reads, 7.25 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18282193-18282284 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-450a-2
bta-mir-424chrX: 18288411-18288506 [-]
bta-mir-503chrX: 18288067-18288149 [-]
bta-mir-3601chrX: 18283115-18283192 [+]
bta-mir-542chrX: 18283105-18283201 [-]
bta-mir-450a-2chrX: 18282193-18282284 [-]
bta-mir-450a-1chrX: 18282042-18282123 [-]
bta-mir-450bchrX: 18281872-18281957 [-]
Database links

Mature sequence bta-miR-450a

Accession MIMAT0003834
Previous IDsbta-miR-450
Sequence

22 - 

uuuugcgauguguuccuaauau

 - 43

Get sequence
Deep sequencing10304 reads, 69 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).