Stem-loop sequence bta-mir-425

AccessionMI0005047 (change log)
DescriptionBos taurus miR-425 stem-loop
Gene family MIPF0000242; mir-425
Literature search

5 open access papers mention bta-mir-425
(8 sentences)

Stem-loop
        c  u    aau       u  c     u  ----ag   g 
5' gaaag gc uugg   gacacga ca ucccg ug      ugg c
   ||||| || ||||   ||||||| || ||||| ||      |||  
3' cuuuc cg gacc   cugugcu gu agggc ac      acc a
        u  u    cgc       -  a     u  cgaaga   c 
Get sequence
Deep sequencing
23963 reads, 207 reads per million, 75 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 51728006-51728092 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-425
bta-mir-191chr22: 51727524-51727614 [+]
bta-mir-191bchr22: 51727536-51727599 [-]
bta-mir-425chr22: 51728006-51728092 [+]
Database links

Mature sequence bta-miR-425-5p

Accession MIMAT0003832
Sequence

15 - 

augacacgaucacucccguuga

 - 36

Get sequence
Deep sequencing22225 reads, 75 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence bta-miR-425-3p

Accession MIMAT0003833
Sequence

55 - 

aucgggaaugucguguccgccc

 - 76

Get sequence
Deep sequencing1738 reads, 73 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).