Stem-loop sequence bta-mir-361

AccessionMI0005045 (change log)
DescriptionBos taurus miR-361 stem-loop
Gene family MIPF0000172; mir-361
Literature search

5 open access papers mention bta-mir-361
(13 sentences)

Stem-loop
        uu         --u  a    u    auaa 
5' ggagc  aucagaauc   cc gggg acuu    u
   |||||  |||||||||   || |||| ||||    u
3' cuucg  uagucuuag   gg cccc ugaa    u
        uu         ugu  a    c    aaag 
Get sequence
Deep sequencing
17153 reads, 204 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 75231068-75231138 [+]
sense
ENSBTAT00000012631 ; CHM-201; intron 9
Database links

Mature sequence bta-miR-361

Accession MIMAT0003830
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing11428 reads, 74 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).