Stem-loop sequence bta-mir-29b-2

AccessionMI0005043 (change log)
Previous IDsbta-mir-29b
DescriptionBos taurus miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

39 open access papers mention bta-mir-29b-2
(259 sentences)

Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 
Get sequence
Deep sequencing
142267 reads, 674 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 77732601-77732681 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-29b-2
bta-mir-29b-2chr16: 77732601-77732681 [+]
bta-mir-29cchr16: 77733161-77733248 [+]
Database links

Mature sequence bta-miR-29b

Accession MIMAT0003828
Sequence

52 - 

uagcaccauuugaaaucaguguu

 - 74

Get sequence
Deep sequencing284410 reads, 76 experiments
Evidence experimental; cloned [1,4], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).