Stem-loop sequence bta-mir-22

AccessionMI0005041 (change log)
DescriptionBos taurus miR-22 stem-loop
Gene family MIPF0000053; mir-22
Literature search

21 open access papers mention bta-mir-22
(69 sentences)

Stem-loop
      u   cc               -     a      u  ccu 
5' ggc gag  gcaguaguucuucag uggca gcuuua gu   g
   ||| |||  ||||||||||||||| ||||| |||||| ||   a
3' ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
      u   -c               g     -      -  acc 
Get sequence
Deep sequencing
1123302 reads, 2.59e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 23514297-23514381 [-]
sense
ENSBTAT00000042309 ; bta-mir-22-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-22
bta-mir-3600chr19: 23514299-23514379 [+]
bta-mir-22chr19: 23514297-23514381 [-]
Database links

Mature sequence bta-miR-22-5p

Accession MIMAT0003826
Sequence

15 - 

aguucuucaguggcaagcuuua

 - 36

Get sequence
Deep sequencing1249 reads, 70 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

Mature sequence bta-miR-22-3p

Accession MIMAT0012536
Sequence

53 - 

aagcugccaguugaagaacug

 - 73

Get sequence
Deep sequencing1122051 reads, 78 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3