Stem-loop sequence bta-mir-210

AccessionMI0005039 (change log)
DescriptionBos taurus miR-210 stem-loop
Gene family MIPF0000086; mir-210
Literature search

10 open access papers mention bta-mir-210
(19 sentences)

Stem-loop
   --------cc      c    gg     a   cc   -      c  c -     
5'           uccagg gcag  cagcc cug  cac cgcaca ug g cugc 
             |||||| ||||  ||||| |||  ||| |||||| || | ||| u
3'           gggucc uguc  gucgg gac  gug gcgugu ac c ggcc 
   ccagcgcgac      c    ua     c   -a   u      c  c a     
Get sequence
Deep sequencing
11342 reads, 66.2 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 51369011-51369108 [+]
intergenic
Database links

Mature sequence bta-miR-210

Accession MIMAT0003824
Sequence

54 - 

acugugcgugugacagcggcuga

 - 76

Get sequence
Deep sequencing10897 reads, 73 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2