Stem-loop sequence bta-mir-200c

Accession MI0005038
Description Bos taurus miR-200c stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----    -      a        u   u   gg 
    cguc uuaccc gcaguguu ggg gcu  u
    |||| |||||| |||||||| ||| |||  u
    guag aauggg cgucauaa cuc uga  g
ggag    u      c        u   -   gg 
Get sequence
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr5: 103859436-103859500 [-]
sense
ENSBTAT00000015103 ; LIN7A_BOVIN; intron 2
Clustered miRNAs
< 10kb from bta-mir-200c
bta-mir-200c chr5: 103859436-103859500 [-]
bta-mir-141 chr5: 103859005-103859094 [-]
Database links

Mature sequence bta-miR-200c

Accession MIMAT0003823
Sequence

41 - 

uaauacugccggguaaugaugga

 - 63

Get sequence
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).