Stem-loop sequence bta-mir-200c

AccessionMI0005038 (change log)
DescriptionBos taurus miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

22 open access papers mention bta-mir-200c
(64 sentences)

Stem-loop
   ----    -      a        u   u   gg 
5'     cguc uuaccc gcaguguu ggg gcu  u
       |||| |||||| |||||||| ||| |||  u
3'     guag aauggg cgucauaa cuc uga  g
   ggag    u      c        u   -   gg 
Get sequence
Deep sequencing
50531 reads, 644 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 104150173-104150237 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-200c
bta-mir-200cchr5: 104150173-104150237 [-]
bta-mir-141chr5: 104149742-104149831 [-]
Database links

Mature sequence bta-miR-200c

Accession MIMAT0003823
Sequence

41 - 

uaauacugccggguaaugaugga

 - 63

Get sequence
Deep sequencing50440 reads, 77 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).