Stem-loop sequence bta-mir-181c

AccessionMI0005032 (change log)
DescriptionBos taurus miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

19 open access papers mention bta-mir-181c
(58 sentences)

Stem-loop
   ----uug   a  g       gaa        cu       a     ggca 
5'        cca gg uuugggg   cauucaac  gucggug guuug    g
          ||| || |||||||   ||||||||  ||||||| |||||    c
3'        ggu cc gagcccc   gugaguug  cagcuac caaac    u
   ccgucaa   -  g       -ag        -c       -     ggac 
Get sequence
Deep sequencing
49461 reads, 303 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 12978745-12978841 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-181c
bta-mir-181cchr7: 12978745-12978841 [+]
bta-mir-181dchr7: 12978911-12979023 [+]
Database links

Mature sequence bta-miR-181c

Accession MIMAT0003817
Sequence

19 - 

aacauucaaccugucggugaguuu

 - 42

Get sequence
Deep sequencing42873 reads, 71 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).