Stem-loop sequence bta-mir-138-2

AccessionMI0005029 (change log)
Previous IDsbta-mir-138
DescriptionBos taurus miR-138-2 stem-loop
Gene family MIPF0000075; mir-138
Literature search

8 open access papers mention bta-mir-138-2
(16 sentences)

Stem-loop
   - u   u  ag             uca     -ac   c  cg 
5'  g ugc gc  cugguguugugaa   ggccg   gag ag  c
    | ||| ||  |||||||||||||   |||||   ||| ||   
3'  c acg ug  gaccacagcacuu   ucggc   uuc uc  a
   a u   u  -g             -ua     cca   -  cu 
Get sequence
Deep sequencing
4351 reads, 20.9 reads per million, 67 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 25049218-25049300 [+]
sense
ENSBTAT00000042317 ; bta-mir-138-2-201; exon 1
Database links

Mature sequence bta-miR-138

Accession MIMAT0003813
Sequence

9 - 

agcugguguugugaaucaggccg

 - 31

Get sequence
Deep sequencing8582 reads, 67 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).