Stem-loop sequence bta-mir-132

AccessionMI0005028 (change log)
DescriptionBos taurus miR-132 stem-loop
Gene family MIPF0000065; mir-132
Literature search

15 open access papers mention bta-mir-132
(50 sentences)

Stem-loop
   c   cccc    -  c a    a         uuc          -g     
5'  cgc    gcgu cu c gggc accguggcu   gauuguuacu  uggg 
    |||    |||| || | |||| |||||||||   ||||||||||  ||| a
3'  gcg    cgca ga g cccg ugguaccga   cugacaaugg  gcca 
   c   cacc    c  c c    c         cau          ag     
Get sequence
Deep sequencing
4855 reads, 25.4 reads per million, 67 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 23783488-23783588 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-132
bta-mir-212chr19: 23783918-23784028 [-]
bta-mir-132chr19: 23783488-23783588 [-]
Database links

Mature sequence bta-miR-132

Accession MIMAT0003812
Sequence

59 - 

uaacagucuacagccauggucg

 - 80

Get sequence
Deep sequencing4648 reads, 67 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).