Stem-loop sequence bta-mir-124a-1

AccessionMI0005027 (change log)
Previous IDsbta-mir-124a
DescriptionBos taurus miR-124a-1 stem-loop
Gene family MIPF0000021; mir-124
Literature search

8 open access papers mention bta-mir-124a-1
(10 sentences)

Stem-loop
   a      uc   cc        a   ga        uaaau 
5'  ggccuc  ucu  guguucac gcg  ccuugauu     g
    ||||||  |||  |||||||| |||  ||||||||     u
3'  ucgggg  aga  cguaagug cgc  ggaauuaa     c
   g      ua   ac        g   ac        cauac 
Get sequence
Deep sequencing
192 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr8: 9221497-9221581 [+]
intergenic
Database links

Mature sequence bta-miR-124a

Accession MIMAT0003811
Sequence

53 - 

uaaggcacgcggugaaugccaag

 - 75

Get sequence
Deep sequencing382 reads, 50 experiments
Evidence experimental; cloned [2,4], Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).