Stem-loop sequence MI0005026

Accession MI0005026
ID bta-let-7d
Description Bos taurus let-7d stem-loop
Stem-loop 
       a              c      u  -------      g 
ccuagga gagguaguagguug auaguu uc       gggcag g
||||||| |||||||||||||| |||||| ||       |||||| a
ggauucu uuccgucguccagc uaucaa gg       cccguu u
       -              a      u  aggaaca      u
Get sequence
Genome context
Coordinates (BTAU4.0) Overlapping transcripts
8: 89745858-89745944 [+]
intergenic
Clustered miRNAs
< 10kb from bta-let-7d
bta-let-7a-1 8: 89743299-89743378 [+]
bta-let-7f-1 8: 89743652-89743738 [+]
bta-let-7d 8: 89745858-89745944 [+]
Database links
Gene family

MIPF0000002; let-7

Mature sequence MIMAT0003810

Accession MIMAT0003810
ID bta-let-7d
Sequence

8 -  

agagguaguagguugcauaguu

 - 29

Get sequence
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).