Stem-loop sequence bta-mir-98

AccessionMI0005025 (change log)
DescriptionBos taurus miR-98 stem-loop
Gene family MIPF0000002; let-7
Literature search

7 open access papers mention bta-mir-98
(30 sentences)

Stem-loop
   a   cuc    -     ug   u                 u    ---------      aggg 
5'  gga   ugcu caugc  ggg gagguaguaaguuguau guug         uggggu    a
    |||   |||| |||||  ||| ||||||||||||||||| ||||         ||||||    u
3'  cuu   acga gugug  ccc uuucaucauucaacaua caau         accccg    u
   a   -ac    u     gu   -                 u    agaaguuua      gauu 
Get sequence
Deep sequencing
2656641 reads, 1.25e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 97465740-97465858 [-]
sense
ENSBTAT00000008060 ; HUWE1-201; intron 60
Clustered miRNAs
< 10kb from bta-mir-98
bta-let-7f-2chrX: 97466644-97466726 [-]
bta-mir-98chrX: 97465740-97465858 [-]
Database links

Mature sequence bta-miR-98

Accession MIMAT0003809
Sequence

22 - 

ugagguaguaaguuguauuguu

 - 43

Get sequence
Deep sequencing2654823 reads, 78 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).