Stem-loop sequence bta-mir-92a-2

AccessionMI0005024 (change log)
Previous IDsbta-mir-92
DescriptionBos taurus miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Literature search

30 open access papers mention bta-mir-92a-2
(63 sentences)

Stem-loop
   -------u    g     uu  u   c     -      
5'         gggu gggau  gu gca ugcuu guguu 
           |||| |||||  || ||| ||||| |||| a
3'         uccg cccug  ca cgu augaa uauau 
   agaaggug    g     uu  -   u     a      
Get sequence
Deep sequencing
1135943 reads, 1e+04 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18021187-18021254 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-92a-2
bta-mir-106achrX: 18021857-18021937 [-]
bta-mir-18bchrX: 18021698-18021772 [-]
bta-mir-20bchrX: 18021463-18021531 [-]
bta-mir-19b-2chrX: 18021338-18021420 [-]
bta-mir-92a-2chrX: 18021187-18021254 [-]
bta-mir-363chrX: 18021032-18021105 [-]
Database links

Mature sequence bta-miR-92a

Accession MIMAT0009383
Sequence

41 - 

uauugcacuugucccggccugu

 - 62

Get sequence
Deep sequencing2284771 reads, 77 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).