Stem-loop sequence bta-mir-487a

AccessionMI0005022 (change log)
DescriptionBos taurus miR-487a stem-loop
Gene family MIPF0000018; mir-154
Literature search

2 open access papers mention bta-mir-487a
(3 sentences)

Stem-loop
         u     g   uua      c    -    cu  a 
5' gguacu gaaga ugg   ucccug ugug uucg  gu u
   |||||| ||||| |||   |||||| |||| ||||  ||  
3' cuauga uuuuu acc   agggac auac aagc  ua u
         c     g   uac      -    u    ag  u 
Get sequence
Deep sequencing
392 reads, 0 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67868237-67868316 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-487a
bta-mir-1185chr21: 67859743-67859828 [+]
bta-mir-3956chr21: 67860482-67860579 [+]
bta-mir-381chr21: 67861446-67861520 [+]
bta-mir-487bchr21: 67861931-67862014 [+]
bta-mir-539chr21: 67862745-67862822 [+]
bta-mir-544achr21: 67864731-67864821 [+]
bta-mir-655chr21: 67865688-67865784 [+]
bta-mir-411cchr21: 67867851-67867924 [+]
bta-mir-487achr21: 67868237-67868316 [+]
bta-mir-3578chr21: 67871246-67871331 [-]
bta-mir-382chr21: 67871251-67871326 [+]
bta-mir-134chr21: 67871630-67871702 [+]
bta-mir-668chr21: 67872162-67872257 [+]
bta-mir-485chr21: 67872328-67872400 [+]
bta-mir-453chr21: 67873059-67873138 [+]
bta-mir-154achr21: 67876412-67876495 [+]
bta-mir-154bchr21: 67876730-67876810 [+]
bta-mir-496chr21: 67877242-67877342 [+]
Database links

Mature sequence bta-miR-487a

Accession MIMAT0003805
Sequence

49 - 

aaucauacagggacauccagu

 - 69

Get sequence
Deep sequencing360 reads, 59 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).