Stem-loop sequence bta-mir-380

AccessionMI0005021 (change log)
DescriptionBos taurus miR-380 stem-loop
Gene family MIPF0000126; mir-379
Literature search

1 open access papers mention bta-mir-380
(5 sentences)

Stem-loop
         guu       ga       - ugu 
5' aagaug   gaccaua  acaugcg c   c
   ||||||   |||||||  ||||||| |   u
3' uucugc   cuggugu  uguaugc g   c
         -ac       aa       u uau 
Get sequence
Deep sequencing
8302 reads, 65.1 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67843176-67843236 [+]
sense
ENSBTAT00000042149 ; bta-mir-380-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-380
bta-mir-379chr21: 67840242-67840327 [+]
bta-mir-411achr21: 67841471-67841552 [+]
bta-mir-299chr21: 67841943-67842005 [+]
bta-mir-299-2chr21: 67841948-67841999 [-]
bta-mir-380chr21: 67843176-67843236 [+]
bta-mir-411bchr21: 67843330-67843404 [+]
bta-mir-1197chr21: 67843672-67843768 [+]
bta-mir-323chr21: 67843841-67843926 [+]
bta-mir-758chr21: 67844139-67844226 [+]
bta-mir-329bchr21: 67844880-67844962 [+]
bta-mir-329achr21: 67845190-67845272 [+]
bta-mir-494chr21: 67848049-67848133 [+]
bta-mir-1193chr21: 67848381-67848485 [+]
bta-mir-543chr21: 67850198-67850277 [+]
bta-mir-495chr21: 67851608-67851688 [+]
Database links

Mature sequence bta-miR-380-5p

Accession MIMAT0003803
Sequence

5 - 

ugguugaccauagaacaugcgc

 - 26

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Array [2], qRT-PCR [2]
Predicted targets

Mature sequence bta-miR-380-3p

Accession MIMAT0003804
Sequence

40 - 

uauguaaugugguccacgucu

 - 60

Get sequence
Deep sequencing8296 reads, 63 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).