Stem-loop sequence bta-mir-30e

AccessionMI0005018 (change log)
DescriptionBos taurus miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

20 open access papers mention bta-mir-30e
(127 sentences)

Stem-loop
   g        uu  ua            uu           g aag    
5'  ggcagucu  gc  cuguaaacaucc  gacuggaagcu u   gcg 
    ||||||||  ||  ||||||||||||  ||||||||||| |   || u
3'  ccgucgga  cg  gacauuuguagg  cugacuuucga g   cgu 
   a        --  gc            --           g -aa    
Get sequence
Deep sequencing
1056472 reads, 3.36e+04 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 106453038-106453129 [-]
sense
ENSBTAT00000029254 ; NFYC-201; intron 5
Clustered miRNAs
< 10kb from bta-mir-30e
bta-mir-30echr3: 106453038-106453129 [-]
bta-mir-30cchr3: 106449904-106450008 [-]
Database links

Mature sequence bta-miR-30e-5p

Accession MIMAT0003799
Sequence

17 - 

uguaaacauccuugacuggaagcu

 - 40

Get sequence
Deep sequencing1024512 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).