Stem-loop sequence bta-mir-218-2

AccessionMI0005017 (change log)
Previous IDsbta-mir-218
DescriptionBos taurus miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Literature search

4 open access papers mention bta-mir-218-2
(5 sentences)

Stem-loop
   uuu         cu        gguggaacga  g 
5'    gugcuugau  aaccaugu          ug a
      |||||||||  ||||||||          ||  
3'    cacgaacug  uugguaca          gc a
   --c         uc        --------ag  a 
Get sequence
Deep sequencing
5483 reads, 9.23 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 443261-443322 [-]
sense
ENSBTAT00000042274 ; bta-mir-218-2-201; exon 1
ENSBTAT00000049620 ; SLIT3-201; intron 8
Database links

Mature sequence bta-miR-218

Accession MIMAT0003798
Sequence

2 - 

uugugcuugaucuaaccaugug

 - 23

Get sequence
Deep sequencing10958 reads, 64 experiments
Evidence experimental; cloned [1,3-4]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2