Stem-loop sequence bta-mir-215

AccessionMI0005016 (change log)
DescriptionBos taurus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

9 open access papers mention bta-mir-215
(20 sentences)

Stem-loop
   u        aaa  a     -   u         -  gug 
5'  guacagga   ug ccuau gaa ugacagaca ac   a
    ||||||||   || ||||| ||| ||||||||| ||    
3'  uaugucuu   ac ggaug cuu acugucugu ug   c
   -        gua  c     u   u         c  aau 
Get sequence
Deep sequencing
13584980 reads, 1.09e+05 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 24404933-24405011 [-]
antisense
ENSBTAT00000061457 ; IARS2-201; intron 12
Clustered miRNAs
< 10kb from bta-mir-215
bta-mir-194bchr16: 24405226-24405310 [+]
bta-mir-194-1chr16: 24405220-24405316 [-]
bta-mir-215chr16: 24404933-24405011 [-]
Database links

Mature sequence bta-miR-215

Accession MIMAT0003797
Sequence

12 - 

augaccuaugaauugacagaca

 - 33

Get sequence
Deep sequencing13532276 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).