Stem-loop sequence bta-mir-20b

AccessionMI0005015 (change log)
DescriptionBos taurus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

10 open access papers mention bta-mir-20b
(20 sentences)

Stem-loop
        -ca           g     g   uuuu     
5' aguac   aagugcucaca ugcag uag    ggca 
   |||||   ||||||||||| ||||| |||    ||| g
3' ucaug   uucacgggugu auguc auc    ucgc 
        acc           g     -   ----     
Get sequence
Deep sequencing
11621 reads, 58.6 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18021463-18021531 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-20b
bta-mir-106achrX: 18021857-18021937 [-]
bta-mir-18bchrX: 18021698-18021772 [-]
bta-mir-20bchrX: 18021463-18021531 [-]
bta-mir-19b-2chrX: 18021338-18021420 [-]
bta-mir-92a-2chrX: 18021187-18021254 [-]
bta-mir-363chrX: 18021032-18021105 [-]
Database links

Mature sequence bta-miR-20b

Accession MIMAT0003796
Sequence

6 - 

caaagugcucacagugcaggua

 - 27

Get sequence
Deep sequencing11606 reads, 70 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).