Stem-loop sequence bta-mir-193a

AccessionMI0005014 (change log)
DescriptionBos taurus miR-193a stem-loop
Gene family MIPF0000082; mir-193
Literature search

12 open access papers mention bta-mir-193a
(47 sentences)

Stem-loop 
   u   a      ag     u     cg   g  a    ggu 
5'  ggg gcugag  cuggg cuuug  ggc ag ugaa   g
    ||| ||||||  ||||| |||||  ||| || ||||    
3'  ccc cggcuc  gaccc gaaac  ccg uc acuu   u
   c   -      cu     u     au   g  a    ggc
Get sequence
Deep sequencing
17294 reads, 131 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

High-throughput sequencing suggests that the dominant miRNA arises from the 5' arm of this precursor [2], in contrast to earlier cloning studies.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 18931346-18931426 [-]
intergenic
Database links

Mature sequence bta-miR-193a-5p

Accession MIMAT0003794
Previous IDsbta-miR-193a*
Sequence

15 -  

ugggucuuugcgggcgagauga

 - 36

Get sequence
Deep sequencing6872 reads, 64 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

Mature sequence bta-miR-193a-3p

Accession MIMAT0003795
Previous IDsbta-miR-193a
Sequence

49 -  

aacuggccuacaaagucccagu

 - 70

Get sequence
Deep sequencing10421 reads, 72 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).