Stem-loop sequence bta-mir-181b-2

AccessionMI0005013 (change log)
Previous IDsbta-mir-181b
DescriptionBos taurus miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

23 open access papers mention bta-mir-181b-2
(56 sentences)

Stem-loop
   cuga   -     cuca          cu           u  cu 
5'     ugg cugca    acauucauug  gucgguggguu ga  u
       ||| |||||    ||||||||||  ||||||||||| ||  u
3'     acc ggcgu    uguaaguaac  uagucacucaa cu  g
   acaa   a     caaa          --           -  aa 
Get sequence
Deep sequencing
62360 reads, 478 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr11: 95967281-95967369 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-181b-2
bta-mir-181a-2chr11: 95966066-95966175 [+]
bta-mir-181b-2chr11: 95967281-95967369 [+]
Database links

Mature sequence bta-miR-181b

Accession MIMAT0003793
Sequence

16 - 

aacauucauugcugucgguggguu

 - 39

Get sequence
Deep sequencing124458 reads, 78 experiments
Evidence experimental; cloned [1,3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).