Stem-loop sequence bta-mir-142

AccessionMI0005011 (change log)
DescriptionBos taurus miR-142 stem-loop
Gene family MIPF0000084; mir-142
Literature search

16 open access papers mention bta-mir-142
(76 sentences)

Stem-loop 
   g        g   c           a         uaa ag a 
5'  acagugca uca ccauaaaguag aagcacuac   c  c c
    |||||||| ||| ||||||||||| |||||||||   |  |  
3'  ugucaugu agu gguauuucauc uuugugaug   g  g u
   g        g   a           c         -ug ga g
Get sequence
Deep sequencing
397071 reads, 5.12e+03 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

In addition to the mature miR-142 sequence shown here, Gu et al. also cloned the offset sequence CCCAUAAAGUAGAAAGCACUA just once [2]. This sequence aligns with that cloned in chicken (MI0001281).

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 9627413-9627499 [-]
intergenic
Database links

Mature sequence bta-miR-142-5p

Accession MIMAT0003790
Previous IDsbta-miR-142
Sequence

16 -  

cauaaaguagaaagcacuac

 - 35

Get sequence
Deep sequencing363692 reads, 75 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence bta-miR-142-3p

Accession MIMAT0003791
Previous IDsbta-miR-142*
Sequence

55 -  

aguguuuccuacuuuauggaug

 - 76

Get sequence
Deep sequencing33373 reads, 70 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).