Stem-loop sequence bta-mir-10a

AccessionMI0005007 (change log)
DescriptionBos taurus miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

14 open access papers mention bta-mir-10a
(35 sentences)

Stem-loop
   ----gauc   --c    uu        a    g     c          uaaggaa 
5'         ugu   uguc  cuguauau cccu uagau cgaauuugug       u
           |||   ||||  |||||||| |||| ||||| ||||||||||        
3'         aca   acag  gauguaua gggg aucua gcuuaaacac       u
   cucgccuc   aau    uu        a    -     u          uaguguu 
Get sequence
Deep sequencing
6635780 reads, 7.09e+04 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 38713901-38714009 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-10a
bta-mir-2886chr19: 38707493-38707567 [+]
bta-mir-10achr19: 38713901-38714009 [+]
Database links

Mature sequence bta-miR-10a

Accession MIMAT0003786
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Deep sequencing6634576 reads, 74 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).