Stem-loop sequence bta-mir-107

AccessionMI0005006 (change log)
DescriptionBos taurus miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

12 open access papers mention bta-mir-107
(23 sentences)

Stem-loop
   c   c      --c    u  u           c   u   a 
5'  ucu ugcuuu   agcu cu uacaguguugc uug ggc u
    ||| ||||||   |||| || ||||||||||| ||| ||| g
3'  aga acgaaa   ucgg ga auguuacgacg aac uug g
   -   c      cua    -  c           -   -   a 
Get sequence
Deep sequencing
222103 reads, 1.51e+03 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 11348565-11348645 [-]
sense
ENSBTAT00000042222 ; bta-mir-107-201; exon 1
ENSBTAT00000050296 ; PANK1-201; intron 5
Database links

Mature sequence bta-miR-107

Accession MIMAT0003785
Sequence

50 - 

agcagcauuguacagggcuauc

 - 71

Get sequence
Deep sequencing222058 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).