Stem-loop sequence mmu-mir-615

Accession MI0005004
Symbol MGI:Mir615
Description Mus musculus miR-615 stem-loop
Gene family MIPF0000342; mir-615
Stem-loop 
uc    -    c          uc     u        cu    g ug 
  ggga gggg gggagggggg  cccgg gcucggau  cgag g  c
  |||| |||| ||||||||||  ||||| ||||||||  |||| |  u
  cccu cccc ccuucucccu  ggguc cgagccug  gcuu u  u
--    a    -          cu     -        --    g ua
Get sequence
Deep sequencing
10648 reads, 58 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr15: 103014910-103015001 [+]
sense
OTTMUST00000096505 ; Hoxc5-001; intron 1
OTTMUST00000096497 ; RP24-459N19.4-001; intron 1
ENSMUST00000001709 ; Hoxc5-001; intron 1
ENSMUST00000174869 ; Gm20398-001; intron 1
Database links

Mature sequence mmu-miR-615-5p

Accession MIMAT0004837
Sequence

17 -  

ggggguccccggugcucggauc

 - 38

Get sequence
Deep sequencing 211 reads, 21 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-615-3p

Accession MIMAT0003783
Previous IDs mmu-miR-615
Sequence

60 -  

uccgagccugggucucccucuu

 - 81

Get sequence
Deep sequencing 2690 reads, 41 experiments
Evidence experimental; MPSS [1], cloned [2], Solexa [3-4]
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).