Stem-loop sequence mmu-mir-676

AccessionMI0005003 (change log)
Symbol MGI:Mir676
DescriptionMus musculus miR-676 stem-loop
Gene family MIPF0000471; mir-676
Literature search

7 open access papers mention mmu-mir-676
(14 sentences)

Stem-loop
   cuuu    --        ga   u             uu   gaauu 
5'     gccu  gaaugcau  cuc acaaccuuaggac  gca     a
       ||||  ||||||||  ||| |||||||||||||  |||      
3'     cggg  uuugcgug  gag uguuggaguccug  cgu     a
   ----    uc        uc   u             -c   aagga 
Get sequence
Deep sequencing
75868 reads, 62.8 reads per million, 94 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 100381097-100381185 [+]
sense
OTTMUST00000043583 ; Eda-001; intron 2
OTTMUST00000043584 ; Eda-002; intron 2
OTTMUST00000043778 ; Eda-003; intron 2
OTTMUST00000043779 ; Eda-004; intron 2
OTTMUST00000043780 ; Eda-005; intron 2
OTTMUST00000043781 ; Eda-006; intron 2
OTTMUST00000044402 ; Eda-011; intron 2
ENSMUST00000113779 ; Eda-001; intron 2
ENSMUST00000113776 ; Eda-002; intron 2
ENSMUST00000113775 ; Eda-003; intron 2
ENSMUST00000113780 ; Eda-004; intron 2
ENSMUST00000113778 ; Eda-005; intron 2
ENSMUST00000113781 ; Eda-006; intron 2
ENSMUST00000113783 ; Eda-011; intron 2
ENSMUST00000071453 ; Eda-201; intron 2
ENSMUST00000113777 ; Eda-202; intron 2
Database links

Mature sequence mmu-miR-676-5p

Accession MIMAT0003781
Previous IDsmmu-miR-676*
Sequence

18 - 

acucuacaaccuuaggacuugc

 - 39

Get sequence
Deep sequencing8086 reads, 82 experiments
Evidence experimental; MPSS [1], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-676-3p

Accession MIMAT0003782
Previous IDsmmu-miR-676
Sequence

55 - 

ccguccugagguuguugagcu

 - 75

Get sequence
Deep sequencing67779 reads, 94 experiments
Evidence experimental; MPSS [1], cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).