Stem-loop sequence gga-mir-456

AccessionMI0004997 (change log)
DescriptionGallus gallus miR-456 stem-loop
Gene family MIPF0000341; mir-456
Stem-loop
   auuuaagcu  u  --g gu   c        g   g     uc       acau ug    c 
5'          gc gu   u  gug guguguga cag caucu  ucagccu    g  gauu c
            || ||   |  ||| |||||||| ||| |||||  |||||||    |  ||||  
3'          cg ca   g  uac uacguacu guu guaga  ggucgga    c  cuaa u
   ---------  u  aua uc   u        -   g     uu       ---- gu    a 
Get sequence
Deep sequencing
26903 reads, 200 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 31514576-31514687 [-]
sense
ENSGALT00000017153 ; TTC27-201; intron 9
Database links

Mature sequence gga-miR-456-5p

Accession MIMAT0026645
Sequence

32 - 

caggcaucuucucagccuacaugug

 - 56

Get sequence
Deep sequencing12 reads, 4 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-456-3p

Accession MIMAT0003777
Sequence

71 - 

caggcugguuagaugguuguca

 - 92

Get sequence
Deep sequencing26882 reads, 5 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3]
Database links
Predicted targets

References

1
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).