Stem-loop sequence gga-mir-451

AccessionMI0004995 (change log)
DescriptionGallus gallus miR-451 stem-loop
Gene family MIPF0000148; mir-451
Literature search

9 open access papers mention gga-mir-451
(16 sentences)

Stem-loop
   acaca      g   g a                 a 
5'      uggcug cag g aaccguuaccauuacug g
        |||||| ||| | |||||||||||||||||  
3'      accgac guc u uuggcaaugguaaugau u
   -----      a   g c                 u 
Get sequence
Deep sequencing
386231 reads, 4.4e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 5863036-5863104 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-451
gga-mir-144chr19: 5863191-5863275 [-]
gga-mir-451chr19: 5863036-5863104 [-]
Database links

Mature sequence gga-miR-451

Accession MIMAT0003775
Sequence

18 - 

aaaccguuaccauuacugaguuu

 - 40

Get sequence
Deep sequencing385429 reads, 5 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).