Stem-loop sequence gga-mir-21

AccessionMI0004994 (change log)
DescriptionGallus gallus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

31 open access papers mention gga-mir-21
(202 sentences)

Stem-loop
   -----u      ucc                a     a     a    ugg 
5'       guacca   ugucggauagcuuauc gacug uguug cugu   a
         ||||||   |||||||||||||||| ||||| ||||| ||||    
3'       uauggu   acagucugucggaugg cugac acaac ggua   u
   acucuc      uuu                -     a     -    cuc 
Get sequence
Deep sequencing
2268639 reads, 3.93e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 7376247-7376343 [+]
intergenic
Database links

Mature sequence gga-miR-21-5p

Accession MIMAT0003774
Sequence

18 - 

uagcuuaucagacugauguuga

 - 39

Get sequence
Deep sequencing2266030 reads, 5 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-21-3p

Accession MIMAT0026643
Sequence

56 - 

caacaacagucgguaggcuguc

 - 77

Get sequence
Deep sequencing1976 reads, 5 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).