Stem-loop sequence ebv-mir-BART20

AccessionMI0004993 (change log)
DescriptionEpstein Barr virus miR-BART20 stem-loop
Gene family MIPF0000322; mir-BART20
Stem-loop
       -  --cgu   -   u  u         -a         u  -ug    
5' uaca gg     agg gcc au guagcaggc  ugucuucau cc   cgu 
   |||| ||     ||| ||| || |||||||||  ||||||||| ||   || a
3' augu cc     ucc cgg ua cauuguccg  acggaagua gg   gcc 
       a  uuuuu   a   u  c         ac         c  uaa    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART18 by Grundhoff et al [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 148319-148417 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART20
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]
Database links

Mature sequence ebv-miR-BART20-5p

Accession MIMAT0003719
Sequence

21 - 

uagcaggcaugucuucauucc

 - 41

Get sequence
Evidence experimental; array [1], Northern [1], cloned [2]

Mature sequence ebv-miR-BART20-3p

Accession MIMAT0003720
Sequence

56 - 

caugaaggcacagccuguuacc

 - 77

Get sequence
Evidence experimental; array [1], Northern [1], cloned [2]

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).