Stem-loop sequence ebv-mir-BART18

AccessionMI0004991 (change log)
DescriptionEpstein Barr virus miR-BART18 stem-loop
Gene family MIPF0000948; mir-BART18
Stem-loop
       u  c     --aaga      uc    cu -       c      u      u  u 
5' uugu gc guuga      cgggug  cugg  c aaguucg acuucc auacag gu a
   |||| || |||||      ||||||  ||||  | ||||||| |||||| |||||| ||  
3' agcg cg cagcu      gcucau  gacc  g uucgggu ugaagg uauguu cg a
       u  u     guaaua      gu    cu c       u      c      c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART10 by Grundhoff et al [1] but is not related to ebv-miR-BART10 (MI0003732). The mature miRNA names and sequences reflect cloning frequencies from Landgraf et al. [2], and may differ subtly from previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 145932-146050 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART18
ebv-mir-BART3HHV507799: 139076-139154 [+]
ebv-mir-BART4HHV507799: 139220-139295 [+]
ebv-mir-BART1HHV507799: 139346-139415 [+]
ebv-mir-BART15HHV507799: 139507-139584 [+]
ebv-mir-BART5HHV507799: 139661-139749 [+]
ebv-mir-BART16HHV507799: 139776-139874 [+]
ebv-mir-BART17HHV507799: 139894-139995 [+]
ebv-mir-BART6HHV507799: 140016-140107 [+]
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]
Database links

Mature sequence ebv-miR-BART18-5p

Accession MIMAT0003717
Previous IDsebv-miR-BART18
Sequence

31 - 

ucaaguucgcacuuccuauaca

 - 52

Get sequence
Evidence experimental; array [1], Northern [1], cloned [2]

Mature sequence ebv-miR-BART18-3p

Accession MIMAT0004835
Sequence

67 - 

uaucggaaguuugggcuucguc

 - 88

Get sequence
Evidence experimental; cloned [2]

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).