|
miRBase |
|
Stem-loop sequence ebv-mir-BART18 |
||||||||||||||||||||||||||||||||||||||||||||||
| Accession | MI0004991 | |||||||||||||||||||||||||||||||||||||||||||||
| Description | Epstein Barr virus miR-BART18 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||
| Gene family | MIPF0000948; mir-BART18 | |||||||||||||||||||||||||||||||||||||||||||||
| Stem-loop |
u c --aaga uc cu - c u u u uugu gc guuga cgggug cugg c aaguucg acuucc auacag gu a |||| || ||||| |||||| |||| | ||||||| |||||| |||||| || agcg cg cagcu gcucau gacc g uucgggu ugaagg uauguu cg a u u guaaua gu cu c u c c a |
|||||||||||||||||||||||||||||||||||||||||||||
| Comments |
The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART10 by Grundhoff et al [1] but is not related to ebv-miR-BART10 (MI0003732 ). The mature miRNA names and sequences reflect cloning frequencies from Landgraf et al. [2], and may differ subtly from previous annotations. |
|||||||||||||||||||||||||||||||||||||||||||||
| Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||
Mature sequence ebv-miR-BART18-5p |
|
| Accession | MIMAT0003717 |
| Previous IDs | ebv-miR-BART18 |
| Sequence |
31 - ucaaguucgcacuuccuauaca - 52 |
| Evidence | experimental; array [1], Northern [1], cloned [2] |
Mature sequence ebv-miR-BART18-3p |
|
| Accession | MIMAT0004835 |
| Sequence |
67 - uaucggaaguuugggcuucguc - 88 |
| Evidence | experimental; cloned [2] |
References |
|
| 1 | |
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|