Stem-loop sequence bmo-mir-283

AccessionMI0004984 (change log)
DescriptionBombyx mori miR-283 stem-loop
Gene family MIPF0000054; mir-216
Literature search

4 open access papers mention bmo-mir-283
(4 sentences)

Stem-loop
   a    u  cc    aa             au      c  u 
5'  acgu uc  gacu  auaucagcuggua  ucuggg uu a
    |||| ||  ||||  |||||||||||||  |||||| ||  
3'  ugca ag  uuga  uauggucgacuau  ggaccc aa u
   a    u  ua    ca             -c      u  u 
Get sequence
Deep sequencing
2925 reads, 333 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581701.1: 692153-692235 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-283
bmo-mir-283NW_004581701.1: 692153-692235 [-]
bmo-mir-12NW_004581701.1: 690490-690579 [-]
Database links

Mature sequence bmo-miR-283-5p

Accession MIMAT0004206
Previous IDsbmo-miR-283
Sequence

14 - 

uaaauaucagcugguaauucu

 - 34

Get sequence
Deep sequencing2898 reads, 3 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence bmo-miR-283-3p

Accession MIMAT0015235
Previous IDsbmo-miR-283*
Sequence

50 - 

caggcuaucagcugguauacag

 - 71

Get sequence
Deep sequencing27 reads, 3 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).