Stem-loop sequence bmo-mir-277

AccessionMI0004981 (change log)
DescriptionBombyx mori miR-277 stem-loop
Gene family MIPF0000156; mir-277
Literature search

5 open access papers mention bmo-mir-277
(32 sentences)

Stem-loop
   -   -au             -          -            aagag cc     guu    u 
5'  uug   uacgccucggggu ucgugccagg agugcguuugca     g  gacau   ugcg u
    |||   ||||||||||||| |||||||||| ||||||||||||     |  |||||   ||||  
3'  aac   gugcggggcccua agcauggucu ucacguaaaugu     c  uugua   acgu a
   c   gau             c          a            ---ca aa     ---    u 
Get sequence
Deep sequencing
3291 reads, 500 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581681.1: 3821386-3821507 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-277
bmo-mir-277NW_004581681.1: 3821386-3821507 [-]
bmo-mir-34NW_004581681.1: 3813355-3813452 [-]
Database links

Mature sequence bmo-miR-277-5p

Accession MIMAT0015233
Previous IDsbmo-miR-277*
Sequence

19 - 

ucgugccaggagugcguuugc

 - 39

Get sequence
Deep sequencing24 reads, 3 experiments
Evidence experimental; Illumina [4]
Database links

Mature sequence bmo-miR-277-3p

Accession MIMAT0004203
Previous IDsbmo-miR-277
Sequence

81 - 

uaaaugcacuaucugguacgaca

 - 103

Get sequence
Deep sequencing3265 reads, 3 experiments
Evidence experimental; Northern [2], RT-PCR [3], Illumina [4]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
4
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).