Stem-loop sequence bmo-mir-276

AccessionMI0004980 (change log)
DescriptionBombyx mori miR-276 stem-loop
Gene family MIPF0000124; mir-276
Literature search

6 open access papers mention bmo-mir-276
(13 sentences)

Stem-loop
   c      uua   cu    a     ag         -  aug 
5'  ugguaa   cca  agcg gguau  aguuccuac gu   c
    ||||||   |||  |||| |||||  ||||||||| ||    
3'  accguu   ggu  ucgu ccaua  ucaaggaug ca   u
   a      -ug   uc    g     cu         u  caa 
Get sequence
Deep sequencing
105250 reads, 1.8e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bmo-miR-276-5p

Accession MIMAT0004202
Previous IDsbmo-miR-276
Sequence

16 - 

agcgagguauagaguuccuacg

 - 37

Get sequence
Deep sequencing8733 reads, 3 experiments
Evidence experimental; Northern [2], RT-PCR [3], Illumina [4]
Database links

Mature sequence bmo-miR-276-3p

Accession MIMAT0015232
Previous IDsbmo-miR-276*
Sequence

51 - 

uaggaacuucauaccgugcucu

 - 72

Get sequence
Deep sequencing96517 reads, 3 experiments
Evidence experimental; Illumina [4]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
4
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).