Stem-loop sequence bmo-mir-263a

AccessionMI0004978 (change log)
DescriptionBombyx mori miR-263a stem-loop
Gene family MIPF0000122; mir-263
Literature search

7 open access papers mention bmo-mir-263a
(31 sentences)

Stem-loop
   a   a   aa    a  ca   g     ga   au       uucagu 
5'  ucg ucc  gcac gg  aug cacug  aga  ucacggg      u
    ||| |||  |||| ||  ||| |||||  |||  |||||||      u
3'  agc agg  cgug uc  uac gugau  ucu  agugccc      a
   c   -   -a    g  ac   g     uc   --       uuauau 
Get sequence
Deep sequencing
275182 reads, 5.61e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582020.1: 2312197-2312291 [-]
intergenic
Database links

Mature sequence bmo-miR-263a-5p

Accession MIMAT0004200
Previous IDsbmo-miR-263a
Sequence

19 - 

aauggcacuggaagaauucac

 - 39

Get sequence
Deep sequencing274885 reads, 3 experiments
Evidence experimental; Northern [2], cloned [3], RT-PCR [4], Illumina [5]
Database links

Mature sequence bmo-miR-263a-3p

Accession MIMAT0015230
Previous IDsbmo-miR-263a*
Sequence

60 - 

cgugaucucuuaguggcaucac

 - 81

Get sequence
Deep sequencing297 reads, 3 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
5
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).