Stem-loop sequence bmo-mir-263b

AccessionMI0004977 (change log)
DescriptionBombyx mori miR-263b stem-loop
Gene family MIPF0000122; mir-263
Literature search

7 open access papers mention bmo-mir-263b
(25 sentences)

Stem-loop
   -a   g      uuccuu    c       a     a  a  -  u 
5'   gcc acgcug      ggca ugggaga uucac gg gu ug a
     ||| ||||||      |||| ||||||| ||||| || || || a
3'   ugg ugugac      ccgu gcccuuu aagug cc ca ac u
   ac   -      ucgauu    a       -     -  -  u  u 
Get sequence
Deep sequencing
113 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581687.1: 1534394-1534482 [+]
intergenic
Database links

Mature sequence bmo-miR-263b-5p

Accession MIMAT0004199
Previous IDsbmo-miR-263b
Sequence

15 - 

cuuggcacugggagaauucac

 - 35

Get sequence
Deep sequencing110 reads, 3 experiments
Evidence experimental; cloned [3], Illumina [4]
Database links

Mature sequence bmo-miR-263b-3p

Accession MIMAT0015229
Previous IDsbmo-miR-263b*
Sequence

56 - 

gugaauuucccgaugccuuag

 - 76

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [4]

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).