Stem-loop sequence bmo-mir-124

AccessionMI0004976 (change log)
DescriptionBombyx mori miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

5 open access papers mention bmo-mir-124
(15 sentences)

Stem-loop
   c     ac   cuc           c ga   g     uauau 
5'  agucc  cuc   gcguucacugc g  gcc uuaug     u
    |||||  |||   ||||||||||| |  ||| |||||     u
3'  ucagg  gag   cguaaguggcg c  cgg aauac     a
   c     -c   aac           - -a   -     uuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582020.1: 2869584-2869668 [-]
intergenic
Database links

Mature sequence bmo-miR-124

Accession MIMAT0004198
Sequence

54 - 

uaaggcacgcggugaaugccaag

 - 76

Get sequence
Evidence by similarity; MI0000373

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).