Stem-loop sequence bmo-mir-14

AccessionMI0004974 (change log)
DescriptionBombyx mori miR-14 stem-loop
Gene family MIPF0000182; mir-14
Literature search

9 open access papers mention bmo-mir-14
(56 sentences)

Stem-loop
   u       ug   c           uc   ga     uu 
5'  ugucauu  ugu ggggagagaaa  gac  ggcug  u
    |||||||  ||| |||||||||||  |||  |||||  u
3'  acaguga  aua ccucucucuuu  cug  cugau  a
   u       gu   u           uu   -a     uu 
Get sequence
Deep sequencing
2530 reads, 400 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582033.1: 1273977-1274056 [-]
intergenic
Database links

Mature sequence bmo-miR-14-5p

Accession MIMAT0015227
Previous IDsbmo-miR-14*
Sequence

14 - 

cggggagagaaaucgacgaggcu

 - 36

Get sequence
Deep sequencing468 reads, 3 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence bmo-miR-14-3p

Accession MIMAT0004196
Previous IDsbmo-miR-14
Sequence

48 - 

ucagucuuuuucucucuccua

 - 68

Get sequence
Deep sequencing2062 reads, 3 experiments
Evidence experimental; Northern [2], Illumina [3]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).